Please enter your sequences into the text box in FASTA format.







Example of FASTA Format


 >My_interesting_sequence
 GCCGGAGCTGGCCACGCAGCTGGTGGTGCCGGTGGCGGCGGCGGTCGGC
 ATCGCCTTCGCGGTGCTGCAGTGGGTGCTCGTCTCCAAGGTCAAGGTCG
 CCCCCGAGCCGCGCGCCGAGGGAGGGTCGGCCTCCGCCGCCGGCGGCAA
 GGACGGCGCCACCGAGTACCTCATCGAGGAGGAGGAGGGCCTCAACGAC
 CACAACATCGTCCTCAAGTGCGCCGAGATCCAGACCGCCATCTCCGAAG
 GAGCAACCTCCTTCCTTTTCACTGAATACAAGTATGCCGGAGGATTCAT
 GACCATTTTCGCGGTCCTGATCTTCGTCTTCCTTGGCTCCATCGAGGGG
 TTCAGCACAAAGAGCCAGCCTTGCCATTACAGCGTGGGCAAGACATGCA
 AGCCTGCTCTTGCTAATGCTGCCTTCAGCACAATTGCCTTTGTGCTAGG
 
You can enter more than one sequence at a time. Ensure each sequence starts with a line with ">" at the beginning and the name of the sequence. The results will be displayed on a single page.