Details of Primer Pair 'ABC00046_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00046_L01R010Nils Rostoks2005-03-17 ABC00046_L01 GAGCACGAGGATGAGAGGAG 0 20 Nils Rostoks 2005-03-17 Invitrogen
ABC00046_R01 TTTTACGGGATCAAAGCTGAG 0 21 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC00046_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB