Details of Primer Pair 'ABC00076_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00076_L01R01441Nils Rostoks2003-11-12 ABC00076_L01 TGCAGCGAAGGGAAAGAAGG 93 20 Nils Rostoks 2003-11-12 Qiagen
ABC00076_R01 GCCTTCTTCGGGGACTTGGT 53 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00076_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes