Details of Primer Pair 'ABC00086_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00086_L01R01418Nils Rostoks2003-11-12 ABC00086_L01 GCCCAGTGAGTGTGGCCTTT 870 20 Nils Rostoks 2003-11-12 Qiagen
ABC00086_R01 GGGGCTCACTGCAACCGTAG 128 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00086_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes