Details of Primer Pair 'ABC00089_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00089_L01R01524Nils Rostoks2003-11-12 ABC00089_L01 GCCTTCGAGCCTTCCTCCAT 1034 20 Nils Rostoks 2003-11-12 Qiagen
ABC00089_R01 ACTCGGGCACATCACAGGGT 155 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00089_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes