Details of Primer Pair 'ABC00091_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00091_L01R01593Nils Rostoks2003-11-12 ABC00091_L01 GCACCCCATCATCAAGGAGC 2181 20 Nils Rostoks 2003-11-12 Qiagen
ABC00091_R01 ACTCTGCTCGTACCACCGCC 277 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00091_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes