Details of Primer Pair 'ABC00103_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00103_L01R01168Nils Rostoks2005-03-17 ABC00103_L01 GGTAAGGAGTGGGTCTCAGG 1380 20 Nils Rostoks 2005-03-17 Invitrogen
ABC00103_R01 CAAGCAGATGCAACTACACC 1548 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC00103_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB