Details of Primer Pair 'ABC00149_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00149_L01R010Nils Rostoks and Joanne Russel2005-03-17 ABC00149_L01 TTGTGGGGTTTTACCTGTGA 0 20 Nils Rostoks and Joanne Russel 2005-03-17 Invitrogen
ABC00149_R01 ACAAACCAACCGAGCAGAAT 0 20 Nils Rostoks and Joanne Russel 2005-03-17 Invitrogen

Comment History of 'ABC00149_L01R01'

No comments recorded for ABC00149_L01R01.