Details of Primer Pair 'ABC00177_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00177_L02R020Nils Rostoks2005-03-17 ABC00177_L02 AATCTGCTCATCCCATCTGC 0 20 Nils Rostoks 2005-03-17 Invitrogen
ABC00177_R02 GTTCAGGCAATGCAGCATAA 0 20 Nils Rostoks 2005-03-17 Invitrogen

Details of Primer Pair 'ABC00177_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00177_L01R01471Nils Rostoks2003-11-12 ABC00177_L01 GGCTATGTCATCCGCAACCC 1256 20 Nils Rostoks 2003-11-12 Qiagen
ABC00177_R01 GCACTCCCAGGAAGAACGGA 172 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00177_L02R02'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB

Comment History of 'ABC00177_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes