Details of Primer Pair 'ABC00314_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00314_L01R01415Nils Rostoks2003-11-12 ABC00314_L01 TTGGCAAGTGCTGTGGCAAT 673 20 Nils Rostoks 2003-11-12 Qiagen
ABC00314_R01 TATCGCAGGCGGGTGTTTTT 108 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00314_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes