Details of Primer Pair 'ABC00334_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00334_L01R01204Nils Rostoks2005-03-17 ABC00334_L01 CAAACAGCCACTGTCCTAGC 36 20 Nils Rostoks 2005-03-17 Invitrogen
ABC00334_R01 AGGGCGAGGTAGATGACG 240 18 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC00334_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB