Details of Primer Pair 'ABC00383_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00383_L01R01403Nils Rostoks2003-11-12 ABC00383_L01 TCATGGCATCTTTGGCTCTGA 803 21 Nils Rostoks 2003-11-12 Qiagen
ABC00383_R01 CAGGAAGCCAAGGCGCTAGT 120 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00383_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes