Details of Primer Pair 'ABC00388_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00388_L01R01493Nils Rostoks2003-11-12 ABC00388_L01 CCGATACACTCTGAGCGGCA 1924 20 Nils Rostoks 2003-11-12 Qiagen
ABC00388_R01 GCCAAACTGCATCACCAACG 241 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00388_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes