Details of Primer Pair 'ABC00460_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00460_L01R0198Nils Rostoks and Joanne Russel2005-03-17 ABC00460_L01 TTGAAGACATCCTCCGTGCT 236 20 Nils Rostoks and Joanne Russel 2005-03-17 Invitrogen
ABC00460_R01 CCCGAATGTAGTCCCAGACA 334 20 Nils Rostoks and Joanne Russel 2005-03-17 Invitrogen

Comment History of 'ABC00460_L01R01'

No comments recorded for ABC00460_L01R01.