Details of Primer Pair 'ABC00592_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00592_L01R01433Nils Rostoks2003-11-12 ABC00592_L01 GAGCAGCACATCACGCCAGT 890 20 Nils Rostoks 2003-11-12 Qiagen
ABC00592_R01 AGTCCAAGCAGGAGCATCCG 132 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00592_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes