Details of Primer Pair 'ABC00600_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00600_L01R01416Nils Rostoks2003-11-12 ABC00600_L01 GCAGTCAGACAGGCGATTGG 1211 20 Nils Rostoks 2003-11-12 Qiagen
ABC00600_R01 TCAGGAACCGCCTCCTTGAG 162 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00600_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes