Details of Primer Pair 'ABC00610_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00610_L01R01568Nils Rostoks2003-11-12 ABC00610_L01 AGGCCTTCACTGTCCGCAAC 206 20 Nils Rostoks 2003-11-12 Qiagen
ABC00610_R01 ACCAGGCTGTTGGGGATTCA 77 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00610_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes