Details of Primer Pair 'ABC00634_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00634_L01R01432Nils Rostoks2003-11-12 ABC00634_L01 CACCTGGGGCATCTTCAACC 186 20 Nils Rostoks 2003-11-12 Qiagen
ABC00634_R01 TAGCCGTCCTTGAGCTTGCC 61 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00634_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes