Details of Primer Pair 'ABC00635_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00635_L01R01400Nils Rostoks2003-11-12 ABC00635_L01 TGAGCAGCCGTGTCAGCTTC 192 20 Nils Rostoks 2003-11-12 Qiagen
ABC00635_R01 AAACATTGGATTGGGCACGC 59 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00635_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes