Details of Primer Pair 'ABC00680_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00680_L01R01423Nils Rostoks2003-11-12 ABC00680_L01 GCAAAGGTGAGAGGGAGGCA 2759 20 Nils Rostoks 2003-11-12 Qiagen
ABC00680_R01 AGACGGGACAACCGAAACCA 318 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00680_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes