Details of Primer Pair 'ABC00681_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00681_L01R01480Nils Rostoks2003-11-12 ABC00681_L01 ACCACCGGGCAGAAGAACAA 1627 20 Nils Rostoks 2003-11-12 Qiagen
ABC00681_R01 CTTTGCCTGCCTCTGCAACA 210 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00681_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes