Details of Primer Pair 'ABC00694_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00694_L01R01504Nils Rostoks2003-11-12 ABC00694_L01 CTCCAGGGAATGCGCTATGG 1680 20 Nils Rostoks 2003-11-12 Qiagen
ABC00694_R01 AAAGAGGCAAGCGGCACAAC 218 20 Nils Rostoks 2003-11-12 Qiagen

Details of Primer Pair 'ABC00694_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00694_L02R020Nils Rostoks2005-03-17 ABC00694_L02 CAAACAGACGACAAGCGGAGAA 0 22 Nils Rostoks 2005-03-17 Invitrogen
ABC00694_R02 TAGAAAAAGAAAACATCAAGCA 0 22 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC00694_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes

Comment History of 'ABC00694_L02R02'

No comments recorded for ABC00694_L02R02.