Details of Primer Pair 'ABC00703_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00703_L01R010Nils Rostoks and Joanne Russel2005-03-17 ABC00703_L01 TGGCTATGCTTTTGGTAGACG 0 21 Nils Rostoks and Joanne Russel 2005-03-17 Invitrogen
ABC00703_R01 CTCAGGTCCAAACCCAAGAA 0 20 Nils Rostoks and Joanne Russel 2005-03-17 Invitrogen

Comment History of 'ABC00703_L01R01'

No comments recorded for ABC00703_L01R01.