Details of Primer Pair 'ABC00823_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00823_L01R01425Nils Rostoks2003-11-12 ABC00823_L01 GCCTTTGTGCAGCCTGCTTT 2158 20 Nils Rostoks 2003-11-12 Qiagen
ABC00823_R01 CCCTCAACAGCCAATGGGAC 258 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00823_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes