Details of Primer Pair 'ABC00875_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00875_L01R01442Nils Rostoks2003-11-12 ABC00875_L01 CGCCAACTGGCTGACTTCCT 499 20 Nils Rostoks 2003-11-12 Qiagen
ABC00875_R01 TTTTCGCAACATCACGGCTG 94 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00875_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes