Details of Primer Pair 'ABC00892_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00892_L01R01408Nils Rostoks2003-11-12 ABC00892_L01 TCAAGGCAATCAGCGACGAG 1071 20 Nils Rostoks 2003-11-12 Qiagen
ABC00892_R01 CAACAAAACCCCAGAAGCGG 147 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00892_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes