Details of Primer Pair 'ABC00912_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00912_L01R01543Nils Rostoks2003-11-12 ABC00912_L01 ATACCCTCCGCAACAGGGGT 643 20 Nils Rostoks 2003-11-12 Qiagen
ABC00912_R01 GAGACCGAGCAGCAACCACA 118 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00912_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes