Details of Primer Pair 'ABC00917_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00917_L01R01442Nils Rostoks2003-11-12 ABC00917_L01 CCGACTGATGTCGTTGTGGC 913 20 Nils Rostoks 2003-11-12 Qiagen
ABC00917_R01 GGACACGCAGCGAGCTCATA 135 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00917_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes