Details of Primer Pair 'ABC00940_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00940_L01R01181Nils Rostoks2005-03-17 ABC00940_L01 GAGGTTCGATATCCGAAGGA 172 20 Nils Rostoks 2005-03-17 Invitrogen
ABC00940_R01 ACCCTCGGCACTTACAAGG 353 19 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC00940_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB