Details of Primer Pair 'ABC00970_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC00970_L01R01416Nils Rostoks2003-11-12 ABC00970_L01 GATCGTGCCTGTTTCCGAGG 73 20 Nils Rostoks 2003-11-12 Qiagen
ABC00970_R01 ACTCCCACGAATGCAAACCG 48 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC00970_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes