Details of Primer Pair 'ABC01075_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01075_L01R01488Nils Rostoks2003-11-12 ABC01075_L01 CTGGTCATCTTCAGCCCGGT 303 20 Nils Rostoks 2003-11-12 Qiagen
ABC01075_R01 ACCTCTCCCGACTTCCGACC 79 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC01075_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes