Details of Primer Pair 'ABC01149_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01149_L01R01463Nils Rostoks2003-11-12 ABC01149_L01 CAACCGTCCTCTCGATCCGT 35 20 Nils Rostoks 2003-11-12 Qiagen
ABC01149_R01 GAACTTGGTGACGGCCTTGG 49 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC01149_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes