Details of Primer Pair 'ABC01178_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01178_L01R01455Nils Rostoks2003-11-12 ABC01178_L01 AGGAGATCTGCATGTCCGGC 187 20 Nils Rostoks 2003-11-12 Qiagen
ABC01178_R01 TCCCAACTTCTCCTCGGCTG 64 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC01178_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes