Details of Primer Pair 'ABC01198_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01198_L01R01490Nils Rostoks2003-11-12 ABC01198_L01 GAAGCCAAGCATGGTGACCC 854 20 Nils Rostoks 2003-11-12 Qiagen
ABC01198_R01 GCTGGCTAAGGTGCCCTCAA 134 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC01198_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes