Details of Primer Pair 'ABC01204_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01204_L01R01516Nils Rostoks2003-11-12 ABC01204_L01 GGTGAGTATGGGTGGACCGC 1796 20 Nils Rostoks 2003-11-12 Qiagen
ABC01204_R01 GCGCTTAATGTTTGGCCAGC 231 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC01204_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes