Details of Primer Pair 'ABC01216_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01216_L01R01486Nils Rostoks2003-11-12 ABC01216_L01 AGAGATCGTCGGCACCTTCG 538 20 Nils Rostoks 2003-11-12 Qiagen
ABC01216_R01 GACACTGAACGAGGCCGGAT 102 20 Nils Rostoks 2003-11-12 Qiagen

Details of Primer Pair 'ABC01216_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01216_L02R020Nils Rostoks2005-03-17 ABC01216_L02 CCCCATCCATCAGACAAGAG 0 20 Nils Rostoks 2005-03-17 Invitrogen
ABC01216_R02 ACTGCACCTTGTAGCCGATG 228 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC01216_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes

Comment History of 'ABC01216_L02R02'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB