Details of Primer Pair 'ABC01222_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01222_L01R01524Nils Rostoks2003-11-12 ABC01222_L01 CGGAGATCATCGGCACCTTC 576 20 Nils Rostoks 2003-11-12 Qiagen
ABC01222_R01 AACACACGGCACGCATGACT 109 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC01222_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes