Details of Primer Pair 'ABC01242_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01242_L01R01434Nils Rostoks2003-11-12 ABC01242_L01 CCGAGATCATCGGCACCTTC 756 20 Nils Rostoks 2003-11-12 Qiagen
ABC01242_R01 ACGGTAACACGGACGATGGG 118 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC01242_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes