Details of Primer Pair 'ABC01243_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01243_L01R01572Nils Rostoks2003-11-12 ABC01243_L01 GGGGAGGTACATGGGGAAGC 309 20 Nils Rostoks 2003-11-12 Qiagen
ABC01243_R01 GCAATGAGCCAATTGAGGGG 88 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC01243_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes