Details of Primer Pair 'ABC01247_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01247_L01R01585Nils Rostoks2003-11-12 ABC01247_L01 CACCTAGCAACCCCCGTGAC 730 20 Nils Rostoks 2003-11-12 Qiagen
ABC01247_R01 CAAGCACAGGTGCCAAATGC 131 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC01247_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes