Details of Primer Pair 'ABC01249_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01249_L01R01409Nils Rostoks2003-11-12 ABC01249_L01 CAGGCCATCAAGCACTCCCT 316 20 Nils Rostoks 2003-11-12 Qiagen
ABC01249_R01 GTTGTTCATCCGGGACAGCC 72 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC01249_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes