Details of Primer Pair 'ABC01257_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01257_L01R01410Nils Rostoks2003-11-12 ABC01257_L01 AGATCTACTGCCGCGCCAAC 143 20 Nils Rostoks 2003-11-12 Qiagen
ABC01257_R01 CTCGCACCACTTCCAGAGCA 55 20 Nils Rostoks 2003-11-12 Qiagen

Comment History of 'ABC01257_L01R01'

DateSubmitterComment
2003-11-12 Nils Rostoks SCRI SNP discovery project in abiotic stress genes