Details of Primer Pair 'ABC01259_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01259_L01R01675Nils Rostoks2004-05-27 ABC01259_L01 ACGGCATGTCGCAGGTGAAC 100 20 Nils Rostoks 2004-05-27 Qiagen
ABC01259_R01 GCGGCGTAGGGAGCGACT 775 18 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC01259_L01R01'

2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined