Details of Primer Pair 'ABC01327_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01327_L01R01417Nils Rostoks2003-12-01 ABC01327_L01 GAAGTCGACGCTGATGGCAA 289 20 Nils Rostoks 2003-12-01 Illumina
ABC01327_R01 TCGTGCGATCCGTTTTAGCA 705 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01327_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina