Details of Primer Pair 'ABC01334_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01334_L01R01409Nils Rostoks2003-12-01 ABC01334_L01 CCCTGCCGTCCAGTACACCT 268 20 Nils Rostoks 2003-12-01 Illumina
ABC01334_R01 TGATCATGGGTGAGCAGGGA 676 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01334_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina