Details of Primer Pair 'ABC01335_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01335_L01R01453Nils Rostoks2003-12-01 ABC01335_L01 CAGCGTACACGATGCAAGCC 142 20 Nils Rostoks 2003-12-01 Illumina
ABC01335_R01 CATGAGCGAAACGCAGGTGT 594 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01335_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina