Details of Primer Pair 'ABC01374_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01374_L01R01411Nils Rostoks2004-05-27 ABC01374_L01 CAGCTACGGCATCGTCATGG 117 20 Nils Rostoks 2004-05-27 Qiagen
ABC01374_R01 TACAGGGGAACACGGGATCG 528 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC01374_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined