Details of Primer Pair 'ABC01404_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01404_L01R01404Nils Rostoks2003-12-01 ABC01404_L01 CTTCTGGGTGCACAACACGG 723 20 Nils Rostoks 2003-12-01 Illumina
ABC01404_R01 AAGCCGCCTCTGTCAAGTGC 1126 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01404_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina