Details of Primer Pair 'ABC01459_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01459_L01R01512Nils Rostoks2003-12-01 ABC01459_L01 CTCCAGCGGTCACATTGCTG 975 20 Nils Rostoks 2003-12-01 Illumina
ABC01459_R01 CGCTCCCGGCACAAAACTAA 1486 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01459_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina