Details of Primer Pair 'ABC01634_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01634_L01R01401Nils Rostoks2003-12-01 ABC01634_L01 AAGACGGGGCTGCCCTACAT 861 20 Nils Rostoks 2003-12-01 Illumina
ABC01634_R01 CTGACGAAGCACGCTCGCTA 1261 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01634_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina